The Complete List of Suppliers for D(GGTGGCGACGACTCCTGGAGCCCG)

CAS No.139528-83-9 DNA,d(G-G-T-G-G-C-G-A-C-G-A-C-T-C-C-T-G-G-A-G-C-C-C-G) (9CI)

Assay:99% Appearance:powder or liquid Package:according to customer requirements Storage:store in dry dark and ventilated place Transportation:By Sea/Air/Courier Application:It is an important raw material. 

Min. Order:10Gram

Supplier:Zibo Hangyu Biotechnology Development Co., Ltd [ China (Mainland)]

CAS No.139528-83-9 DNA,d(G-G-T-G-G-C-G-A-C-G-A-C-T-C-C-T-G-G-A-G-C-C-C-G) (9CI)

Assay:99.0% Appearance:liquid Package:Grams, Kilograms Storage:Store the container tightly closed in a dry, cool and well-ventilated place. Store apart from foodstuff containers or incompatible materials. Transportation:According to customer request Application:For R&D and commerical use 

Min. Order:100Gram

Supplier:Chemlyte Solutions [ China (Mainland)]

CAS No.139528-83-9 DNA,d(G-G-T-G-G-C-G-A-C-G-A-C-T-C-C-T-G-G-A-G-C-C-C-G) (9CI)

Assay:99% Application:healing drugs 

Min. Order:0

Supplier:Antimex Chemical Limied [ China (Mainland)]

CAS No.139528-83-9 D(GGTGGCGACGACTCCTGGAGCCCG)

Assay:99% Package:box or opp package Storage:cool drum  Transportation:air or sea Application:D(GGTGGCGACGACTCCTGGAGCCCG) 

Min. Order:1Milligram

Supplier:weifang yangxu group co.,ltd [ China (Mainland)]